Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 97804
End position: 97827
Length: 24

DNA sequence
>NC_014310, from 97804 to 97827 (24 bp); Ralstonia solanacearum PSI07 GCCGGTGCAGGTGCAGGTGCAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 97681-98532	Sequence	RPSI07_mp0089 - hypothetical protein (Protein is coded in complementary strand; from 98532 to 97681)