Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 1114139
End position: 1114163
Length: 25

DNA sequence
>NC_014310, from 1114139 to 1114163 (25 bp); Ralstonia solanacearum PSI07 GCGCCACGCCACGCCACGCCACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1114134-1114508	Sequence	RPSI07_mp0918 - hypothetical protein (Protein is coded in complementary strand; from 1114508 to 1114134)