Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 586979
End position: 587005
Length: 27

DNA sequence
>NC_014310, from 586979 to 587005 (27 bp); Ralstonia solanacearum PSI07 GCCAGCAGCGCCAGCAGTGCCAGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 586064-587182	Sequence	RPSI07_mp0449 - signal transduction ggdef domain-containing protein (Protein is coded in complementary strand; from 587182 to 586064)