Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 602957
End position: 602983
Length: 27

DNA sequence
>NC_014310, from 602957 to 602983 (27 bp); Ralstonia solanacearum PSI07 GCGTCTATTGCGTCTATTGTGTCTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 602980-605190	Sequence	RPSI07_mp0463 - aminopeptidase (Protein is coded in complementary strand; from 605190 to 602980)