Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 995256
End position: 995285
Length: 30

DNA sequence
>NC_014310, from 995256 to 995285 (30 bp); Ralstonia solanacearum PSI07 ACGACGACGAAGAGGACGAGGACGAGGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 994437-995327	Sequence	RPSI07_mp0816 hrpF type III secretion system protein hrpf