Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 1442106
End position: 1442141
Length: 36

DNA sequence
>NC_014310, from 1442106 to 1442141 (36 bp); Ralstonia solanacearum PSI07 AAGCCGAGCGGCAGGCCGAGCGGCAGGCCGAGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1441845-1443158	Sequence	RPSI07_mp1176 - muconolactone transporter (Protein is coded in complementary strand; from 1443158 to 1441845)