Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 1667806
End position: 1667841
Length: 36

DNA sequence
>NC_014310, from 1667806 to 1667841 (36 bp); Ralstonia solanacearum PSI07 CCGGGTGCGGGTGCGGGTGCGGGTGCGGGTGCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1667764-1668345	Sequence	RPSI07_mp1370 - hypothetical protein (Protein is coded in complementary strand; from 1668345 to 1667764)