Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 646773
End position: 646812
Length: 40

DNA sequence
>NC_014310, from 646773 to 646812 (40 bp); Ralstonia solanacearum PSI07 CGGTCAGTGCCAGTCAGCGCCAGTCCGTGCCAGTCAGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 646787-647890	Sequence	RPSI07_mp0501 - cobalamin biosynthesis protein (cobw) (Protein is coded in complementary strand; from 647890 to 646787)