Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 1005640
End position: 1005675
Length: 36

DNA sequence
>NC_014310, from 1005640 to 1005675 (36 bp); Ralstonia solanacearum PSI07 CCAGCACCACCAGCACCACCAGCACCACCAGCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1005229-1006203	Sequence	RPSI07_mp0824 popA type III effector (Protein is coded in complementary strand; from 1006203 to 1005229)