Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 1642227
End position: 1642250
Length: 24

DNA sequence
>NC_014310, from 1642227 to 1642250 (24 bp); Ralstonia solanacearum PSI07 CGTTGTGGTTGTGGTTGTCGATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1641082-1644129	Sequence	RPSI07_mp1352 - hemagglutinin-related autotransporter protein (Protein is coded in complementary strand; from 1644129 to 1641082)