Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 1981133
End position: 1981168
Length: 36

DNA sequence
>NC_014310, from 1981133 to 1981168 (36 bp); Ralstonia solanacearum PSI07 CGCTGGCCGCATCGCTGGCCGCGCTGCTGGCCGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1981106-1982557	Sequence	RPSI07_mp1699 - outer membrane drug efflux lipoprotein