Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 2018401
End position: 2018424
Length: 24

DNA sequence
>NC_014310, from 2018401 to 2018424 (24 bp); Ralstonia solanacearum PSI07 TTCGCCGTCGCCTTCGCATTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2017927-2020683	Sequence	RPSI07_mp1725 - surface-exposed adhesin protein (fragment) (Protein is coded in complementary strand; from 2020683 to 2017927)