Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 268472
End position: 268495
Length: 24

DNA sequence
>NC_014310, from 268472 to 268495 (24 bp); Ralstonia solanacearum PSI07 GTGCTGATGCTGGTGCTGCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 267609-271145	Sequence	RPSI07_mp0220 - signal transduction eal-ggdef domains transmembrane protein