Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 408109
End position: 408135
Length: 27

DNA sequence
>NC_014310, from 408109 to 408135 (27 bp); Ralstonia solanacearum PSI07 GGCCAGAACGGCCAGAATGGACAGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 407021-408856	Sequence	RPSI07_mp0346 fliF flagellar basal-body MS-ring and collar protein FliF