Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 659426
End position: 659449
Length: 24

DNA sequence
>NC_014310, from 659426 to 659449 (24 bp); Ralstonia solanacearum PSI07 GTGCTCGTGCTCGTGCTCGTGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 657537-661634	Sequence	RPSI07_mp0510 - cobalamin biosynthesis protein (cobn) (Protein is coded in complementary strand; from 661634 to 657537)