Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 977692
End position: 977718
Length: 27

DNA sequence
>NC_014310, from 977692 to 977718 (27 bp); Ralstonia solanacearum PSI07 CATCGGAGGCGTCGGAGGCGTCGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 974451-978476	Sequence	RPSI07_mp0792 - awr type III effector family protein (Protein is coded in complementary strand; from 978476 to 974451)