Sequence retrieval

Genome: Brachyspira pilosicoli 95/1000
Start position: 600824
End position: 600847
Length: 24

DNA sequence
>NC_014330, from 600824 to 600847 (24 bp); Brachyspira pilosicoli 95/1000 AAATAAAAATAAAACTAATAATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 599679-600878	Sequence	BP951000_0541 - dynein heavy chain (Protein is coded in complementary strand; from 600878 to 599679)