Sequence retrieval

Genome: Acetohalobium arabaticum DSM 5501
Start position: 1067623
End position: 1067646
Length: 24

DNA sequence
>NC_014378, from 1067623 to 1067646 (24 bp); Acetohalobium arabaticum DSM 5501 GAAGTAATGAAGTAGTGAAGTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1065940-1067775	Sequence	Acear_0983 - carbon-monoxide dehydrogenase, catalytic subunit