Sequence retrieval

Genome: Acetohalobium arabaticum DSM 5501
Start position: 1121634
End position: 1121669
Length: 36

DNA sequence
>NC_014378, from 1121634 to 1121669 (36 bp); Acetohalobium arabaticum DSM 5501 AGAAGAGTCAGGATAAAAGTCAGGAGAAGAGTCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1119735-1121765	Sequence	Acear_1037 - hydroxymethylbutenyl pyrophosphate reductase