Sequence retrieval

Genome: Acetohalobium arabaticum DSM 5501
Start position: 1668819
End position: 1668845
Length: 27

DNA sequence
>NC_014378, from 1668819 to 1668845 (27 bp); Acetohalobium arabaticum DSM 5501 TCTTCTTCAGCTTCTTCATCTTCCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1668663-1668887	Sequence	Acear_1568 - hypothetical protein (Protein is coded in complementary strand; from 1668887 to 1668663)