Sequence retrieval

Genome: Acetohalobium arabaticum DSM 5501
Start position: 1683287
End position: 1683316
Length: 30

DNA sequence
>NC_014378, from 1683287 to 1683316 (30 bp); Acetohalobium arabaticum DSM 5501 TTAATAACATTTAGTACCATTTAATCACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1682450-1683307	Sequence	Acear_1584 - VanW family protein (Protein is coded in complementary strand; from 1683307 to 1682450)
ORF... 1683308-1684042	Sequence	Acear_1585 - polysaccharide deacetylase (Protein is coded in complementary strand; from 1684042 to 1683308)