Sequence retrieval

Genome: Acetohalobium arabaticum DSM 5501
Start position: 2224814
End position: 2224837
Length: 24

DNA sequence
>NC_014378, from 2224814 to 2224837 (24 bp); Acetohalobium arabaticum DSM 5501 AATAAAAATCAAAATATAAATTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2224329-2225543	Sequence	Acear_2120 - O-antigen polymerase (Protein is coded in complementary strand; from 2225543 to 2224329)