Sequence retrieval

Genome: Acetohalobium arabaticum DSM 5501
Start position: 2283337
End position: 2283366
Length: 30

DNA sequence
>NC_014378, from 2283337 to 2283366 (30 bp); Acetohalobium arabaticum DSM 5501 TCATCATCATCATCTTCATCATCCTCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2282362-2284449	Sequence	Acear_2171 - OstA family protein (Protein is coded in complementary strand; from 2284449 to 2282362)