Sequence retrieval

Genome: Acetohalobium arabaticum DSM 5501
Start position: 293660
End position: 293683
Length: 24

DNA sequence
>NC_014378, from 293660 to 293683 (24 bp); Acetohalobium arabaticum DSM 5501 GGATGAAGATGAGGAAGAGGATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 293317-293868	Sequence	Acear_0275 - 30S ribosomal protein S30P;sigma 54 modulation protein