Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 1205395
End position: 1205418
Length: 24

DNA sequence
>NC_014387, from 1205395 to 1205418 (24 bp); Butyrivibrio proteoclasticus B316 TCAGTTTCAGTTTCAATTTCAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1205000-1207090	Sequence	bpr_I0975 - polyribonucleotide nucleotidyltransferase