Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 1708628
End position: 1708651
Length: 24

DNA sequence
>NC_014387, from 1708628 to 1708651 (24 bp); Butyrivibrio proteoclasticus B316 CTGCACCTGCTCCTGAACCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1707875-1709113	Sequence	bpr_I1374 fliY flagellar motor switch protein FliY