Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 2466704
End position: 2466727
Length: 24

DNA sequence
>NC_014387, from 2466704 to 2466727 (24 bp); Butyrivibrio proteoclasticus B316 ATGATGATGGTGATGATGGTGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2466078-2467373	Sequence	bpr_I2022 cobW2 cobalamin biosynthesis protein CobW2 (Protein is coded in complementary strand; from 2467373 to 2466078)