Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 2471431
End position: 2471454
Length: 24

DNA sequence
>NC_014387, from 2471431 to 2471454 (24 bp); Butyrivibrio proteoclasticus B316 ATTCCAATTACAATTACAATTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2470699-2471499	Sequence	bpr_I2026 rnfB electron transport complex RnfB (Protein is coded in complementary strand; from 2471499 to 2470699)