Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 924414
End position: 924437
Length: 24

DNA sequence
>NC_014387, from 924414 to 924437 (24 bp); Butyrivibrio proteoclasticus B316 CGATAGCGACAGTGATAGCGATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 915110-925267	Sequence	bpr_I0752 - cell surface CnaB domain-containing protein