Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 1264480
End position: 1264506
Length: 27

DNA sequence
>NC_014387, from 1264480 to 1264506 (27 bp); Butyrivibrio proteoclasticus B316 CCGCAACCGCCGCATCCGCCGCAACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1263964-1264911	Sequence	bpr_I1031 - peptidyl-prolyl cis-trans isomerase FKBP-type (Protein is coded in complementary strand; from 1264911 to 1263964)