Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 3065587
End position: 3065613
Length: 27

DNA sequence
>NC_014387, from 3065587 to 3065613 (27 bp); Butyrivibrio proteoclasticus B316 ACTGTTGTTACTGTTGTTACTGTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3065386-3069228	Sequence	bpr_I2508 - cell surface protein (Protein is coded in complementary strand; from 3069228 to 3065386)