Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 2369376
End position: 2369403
Length: 28

DNA sequence
>NC_014387, from 2369376 to 2369403 (28 bp); Butyrivibrio proteoclasticus B316 ATACCTTATACCTTATACCTTATACCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2369403-2369744	Sequence	bpr_I1950 - ArsC family protein (Protein is coded in complementary strand; from 2369744 to 2369403)