Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 2766724
End position: 2766753
Length: 30

DNA sequence
>NC_014387, from 2766724 to 2766753 (30 bp); Butyrivibrio proteoclasticus B316 AGTCAAAAACATTCAAAAATAATCATAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2765730-2766746	Sequence	bpr_I2263 - LacI family transcriptional regulator