Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 1383705
End position: 1383740
Length: 36

DNA sequence
>NC_014387, from 1383705 to 1383740 (36 bp); Butyrivibrio proteoclasticus B316 CCGCTGTTGTAGCCGCTGTTGTAGCCGTTGTTATAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1383531-1384580	Sequence	bpr_I1124 - hypothetical protein (Protein is coded in complementary strand; from 1384580 to 1383531)