Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 2420980
End position: 2421015
Length: 36

DNA sequence
>NC_014387, from 2420980 to 2421015 (36 bp); Butyrivibrio proteoclasticus B316 TCCCTGTCTCTGTCGCGGTCTCTGTCTCTATCTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2419939-2422017	Sequence	bpr_I1987 - PASTA domain-containing Ser/Thr protein kinase (Protein is coded in complementary strand; from 2422017 to 2419939)