Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 2601911
End position: 2601946
Length: 36

DNA sequence
>NC_014387, from 2601911 to 2601946 (36 bp); Butyrivibrio proteoclasticus B316 ACTGGAGCTTCTACCGGGGCTTCTACTGCAGCCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2600231-2602366	Sequence	bpr_I2124 - hypothetical protein (Protein is coded in complementary strand; from 2602366 to 2600231)