Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 3205259
End position: 3205294
Length: 36

DNA sequence
>NC_014387, from 3205259 to 3205294 (36 bp); Butyrivibrio proteoclasticus B316 TATCTTCAGCTGTATCCTCAGATGTCTCTTCAGCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3204751-3205452	Sequence	bpr_I2626 grpE molecular chaperone GrpE (Protein is coded in complementary strand; from 3205452 to 3204751)