Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 1912971
End position: 1913015
Length: 45

DNA sequence
>NC_014387, from 1912971 to 1913015 (45 bp); Butyrivibrio proteoclasticus B316 TTCTGTAGCAGGAGCTTCTGTAGCAGGTGTCTCTGTTGCAGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1911883-1913064	Sequence	bpr_I1560 - Bmp family protein (Protein is coded in complementary strand; from 1913064 to 1911883)