Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 1958127
End position: 1958171
Length: 45

DNA sequence
>NC_014387, from 1958127 to 1958171 (45 bp); Butyrivibrio proteoclasticus B316 CAGGATCAACCGGATCAGGATCAACTGGTGTTGGATCTACCGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1957379-1959505	Sequence	bpr_I1599 - carbohydrate binding protein (Protein is coded in complementary strand; from 1959505 to 1957379)