Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 2462705
End position: 2462749
Length: 45

DNA sequence
>NC_014387, from 2462705 to 2462749 (45 bp); Butyrivibrio proteoclasticus B316 ACCTGATTCACCGGAGCCTGATTCACCGGAGCCTGATTCACCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2462160-2463242	Sequence	bpr_I2018 - hypothetical protein (Protein is coded in complementary strand; from 2463242 to 2462160)