Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 3303569
End position: 3303613
Length: 45

DNA sequence
>NC_014387, from 3303569 to 3303613 (45 bp); Butyrivibrio proteoclasticus B316 GTTGTCTCAGTTTCTGCTGCCCCAGTTTCTGTTGTCTGTGTGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3302078-3303688	Sequence	bpr_I2750 - peptide ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 3303688 to 3302078)