Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 2597463
End position: 2597510
Length: 48

DNA sequence
>NC_014387, from 2597463 to 2597510 (48 bp); Butyrivibrio proteoclasticus B316 AACCTGAGGAGTATCCTGAGAAGTAGCCTGAGAAGTAGCCTGAGAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2596924-2597880	Sequence	bpr_I2121 - hypothetical protein (Protein is coded in complementary strand; from 2597880 to 2596924)