Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 2926491
End position: 2926538
Length: 48

DNA sequence
>NC_014387, from 2926491 to 2926538 (48 bp); Butyrivibrio proteoclasticus B316 TACTTGCCATAGTACTTTCCGTAGTACTTGCCGTAATACTTACCATAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2926374-2927204	Sequence	bpr_I2396 - polysaccharide biosynthesis protein (Protein is coded in complementary strand; from 2927204 to 2926374)