Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 1486454
End position: 1486505
Length: 52

DNA sequence
>NC_014387, from 1486454 to 1486505 (52 bp); Butyrivibrio proteoclasticus B316 CGCTTATTTATTTAGATTATTTATTTAGATTATTTATTTAGATTATTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1486501-1487388	Sequence	bpr_I1203 hsp33 molecular chaperone Hsp33 (Protein is coded in complementary strand; from 1487388 to 1486501)