Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 2106111
End position: 2106173
Length: 63

DNA sequence
>NC_014387, from 2106111 to 2106173 (63 bp); Butyrivibrio proteoclasticus B316 GGTGTAGGATCTGGATCAACCGGTGTTGGGTCCGGATCTACCGGTGTTGGATCTGGATCTACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2105781-2107424	Sequence	bpr_I1710 cel5C endo-1,4-beta-glucanase (Protein is coded in complementary strand; from 2107424 to 2105781)