Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 2253028
End position: 2253090
Length: 63

DNA sequence
>NC_014387, from 2253028 to 2253090 (63 bp); Butyrivibrio proteoclasticus B316 CTTCAGCCTTCTTTTTCTCTTCTTCGGCTTTCTTCTTTTCTTCCTCGGCCTTCTTTTCCTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2252697-2254370	Sequence	bpr_I1842 - GDSL-family lipase/acylhydrolase (Protein is coded in complementary strand; from 2254370 to 2252697)