Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 2576599
End position: 2576661
Length: 63

DNA sequence
>NC_014387, from 2576599 to 2576661 (63 bp); Butyrivibrio proteoclasticus B316 AGTTCACCAGCTCCGTTATCAAGTTCACCTGCACCATTGTCAAGTTCACCTGCGCCGCTATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2576287-2579265	Sequence	bpr_I2109 - cell surface protein (Protein is coded in complementary strand; from 2579265 to 2576287)