Sequence retrieval

Genome: Butyrivibrio proteoclasticus B316
Start position: 2533322
End position: 2533393
Length: 72

DNA sequence
>NC_014387, from 2533322 to 2533393 (72 bp); Butyrivibrio proteoclasticus B316 CCGCCACCACCTGGTGTAGGATCGCCACCGCCGCCCGGTGTAGGATCGCCGCCACCACCTGGTGTAGGAG GC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2533043-2541100	Sequence	bpr_I2082 - cell surface protein (Protein is coded in complementary strand; from 2541100 to 2533043)