Sequence retrieval

Genome: Paenibacillus polymyxa E681
Start position: 1350638
End position: 1350664
Length: 27

DNA sequence
>NC_014483, from 1350638 to 1350664 (27 bp); Paenibacillus polymyxa E681 CATCATCGCCATCATCGCCATCATCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1350486-1350680	Sequence	PPE_01255 - hypothetical protein (Protein is coded in complementary strand; from 1350680 to 1350486)