Sequence retrieval

Genome: Paenibacillus polymyxa E681
Start position: 143804
End position: 143848
Length: 45

DNA sequence
>NC_014483, from 143804 to 143848 (45 bp); Paenibacillus polymyxa E681 TCCTCTCAAATTGGCACCTCTAAGATTGGCGCCTCTCAAATTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 143601-144413	Sequence	PPE_00114 - hypothetical protein (Protein is coded in complementary strand; from 144413 to 143601)